력사를 찾아서

환기9217해,신시배달5917해 단기 4353해,서기 2020해, 대한민국 101해(나뉨 72해),

Y Chromosome analysis of prehistoric human populations in the West Liao River Valley, Northeast China 중국 동북부 랴오강 계곡의 선사 시대 인구에 대한 Y 염색체 분석

댓글 0

배달국시대/유전학

2019. 10. 21.

BMC Evol Biol. 2013; 13: 216.

Published online 2013 Sep 30. doi: 10.1186/1471-2148-13-216

PMCID: PMC3850526

PMID: 24079706

Y Chromosome analysis of prehistoric human populations in the West Liao River Valley, Northeast China

중국 동북부 랴오강 계곡의 선사 시대 인구에 대한 Y 염색체 분석

Yinqiu Cui,1,2 Hongjie Li,2 Chao Ning,1 Ye Zhang,1 Lu Chen,1 Xin Zhao,3 Erika Hagelberg,4 and Hui Zhou

1,2

Author information Article notes Copyright and License information Disclaimer

 

출처;https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3850526/

번역은 구글번역임.

 

This article has been cited by other articles in PMC.

Associated Data

Supplementary Materials

Go to:

 

Abstract

요약

 

Background

The West Liao River valley in Northeast China is an ecologically diverse region, populated in prehistory by human populations with a wide range of cultures and modes of subsistence. To help understand the human evolutionary history of this region, we performed Y chromosome analyses on ancient human remains from archaeological sites ranging in age from 6500 to 2700 BP.

 

배경

중국 동북부의 서 랴오 강 계곡은 생태적으로 다양한 지역으로, 다양한 문화와 생활 방식을 가진 인류에 의해 선사 시대에 채워져 있습니다. 이 지역의 인간 진화 역사를 이해하기 위해, 우리는 6500 년에서 2700 년 사이의 고고학 유적지에서 고대 인류 유적에 대한 Y 염색체 분석을 수행했습니다.

 

Results

47 of the 70 individuals provided reproducible results. They were assigned into five different Y sub-haplogroups using diagnostic single nucleotide polymorphisms, namely N1 (xN1a, N1c), N1c, C/C3e, O3a (O3a3) and O3a3c. We also used 17 Y short tandem repeat loci in the non-recombining portion of the Y chromosome. There appears to be significant genetic differences between populations of the West Liao River valley and adjacent cultural complexes in the prehistoric period, and these prehistoric populations were shown to carry similar haplotypes as present-day Northeast Asians, but at markedly different frequencies.

 

결과

70 명 중 47 명이 재현 가능한 결과를 제공했습니다. 이들은 진단 단일 뉴클레오타이드 다형성, 즉 N1 (xN1a, N1c), N1c, C / C3e, O3a (O3a3) 및 O3a3c를 사용하여 5 개의 상이한 Y 하위-합 포기로 할당되었다. 우리는 또한 Y 염색체의 비 재조합 부분에서 17 Y 짧은 탠덤 반복 유전자좌를 사용했습니다. 선사 시대에는 서 랴오 강 계곡의 인구와 인접한 문화 단지 사이에 상당한 유전 적 차이가있는 것으로 보이며,이 선사 시대 인구는 오늘날 동북 아시아와 비슷한 일 배체 유형을 가지고 있지만 현저하게 다른 빈도로 나타났습니다.

 

Conclusion

Our results suggest that the prehistoric cultural transitions were associated with immigration from the Yellow River valley and the northern steppe into the West Liao River valley. They reveal the temporal continuity of Y chromosome lineages in populations of the West Liao River valley over 5000 years, with a concurrent increase in lineage diversity caused by an influx of immigrants from other populations.

 

결론

우리의 결과는 선사 시대 문화적 전환이 황하 계곡과 서부 랴오 강 계곡으로 이어지는 북부 이민과 관련이 있음을 시사합니다. 그들은 5000 년 동안 West Liao River 계곡의 인구에서 Y 염색체 계통의 시간적 연속성을 보여 주며, 다른 집단으로부터의 이민자의 유입으로 인한 계통 다양성이 동시에 증가합니다.

 

Background

The West Liao River valley is situated in the southern region of Northeast China, between the Yellow River valley and the Eastern Eurasian steppe. It was occupied by a diverse sequence of human cultures that were different from both the farming populations of the Yellow River Valley and the nomads of the Eurasian steppe [1]. The sequence of cultures include the Hongshan culture (6500–5000 BP), Xiaoheyan culture (5000–4200 BP), Lower Xiajiadian culture (4200–3600 BP), and Upper Xiajiadian culture (3000–2700 BP) (Figure 1). The Hongshan culture is one of the most advanced Neolithic cultures in East Asia, with social stratification, distinctive painted pottery and elaborate jade ornaments. Archaeological investigations suggest that hunting- gathering was the main mode of subsistence, but they also indicate early use of cultigens in the Hongshan Culture. The Xiaoheyan culture adopted the basic features of the Hongshan culture, but had a simpler social organization. It was followed by the Lower Xiajiadian culture, which was marked by a gradual shift to agriculture and the establishment of permanent settlements with relatively high population densities, while retaining some of the hallmarks of the Hongshan culture [2]. It was replaced abruptly by a radically different culture, the Upper Xiajiadian, which was influenced by the Bronze Age cultures of the Northern China steppe [3]. The mode of subsistence shifted from hunting and early farming in the Hongshan and Xiaoheyan cultures, to advanced agriculture in the Lower Xiajiadian culture, and eventually to pastoral nomadism in the Upper Xiajiadian culture [4].

 

서랴오강 계곡은 중국 북동부의 남부 지역, 황하 계곡과 동부 유라시아 대초원 사이에 위치하고 있습니다. 그것은 황하 계곡의 농업 인구와 유라시아 대초원의 유목민과는 다른 다양한 일련의 인간 문화에 의해 점령되었다 [ 1 ]. 문화의 순서에는 홍산 문화 (6500–5000 BP), 샤오 헤이 아 문화 (5000-4200 BP), 시아 자디 언 문화 하강 (4200-3600 BP) 및 시아 자디 언 문화 상한 (3000-2700 BP)이 포함됩니다 (그림  1).). 홍산 문화는 사회 계층화, 독특한 도기류 및 정교한 옥 장식으로 동아시아에서 가장 진보 된 신석기 문화 중 하나입니다. 고고 학적 조사에 따르면 사냥 수집은 주요 생존 방식이지만 홍산 문화에서 초기 품종의 사용을 나타냅니다. Xiaoheyan 문화는 Hongshan 문화의 기본 기능을 채택했지만 더 간단한 사회 조직을 가졌습니다. 그 후 시아 지아의 하문 문화가 이어졌으며, 이는 농업으로의 점진적인 변화와 상대적으로 높은 인구 밀도를 가진 영구 정착지가 확립되었으며 홍산 문화의 특징을 유지했다 [ 2]. 그것은 북중국 대초원의 청동기 시대 문화에 영향을받은 근본적으로 다른 문화 인 시아 자디 언 (Xiajiadian)으로 갑자기 대체되었다 [ 3 ]. 생계의 형태는 홍산과 샤오 헤이안 문화의 사냥과 초기 농업에서 시아 자디 언 하류 문화의 고급 농업으로, 결국 시아 자디 언 어퍼 문화의 목가적 유목주의로 바뀌었다 [ 4 ].

Figure 1

Geographic location of the archaeological sites in this study.

 

 

The West Liao River valley has a long history of human occupation since the Palaeolithic era. Because there is no natural barrier to the southwest or north, people have moved freely in this area since prehistoric times. However, the nature of these population movements and their contribution to any transition in subsistence strategy is a subject of heated discussion. A particularly interesting question is whether population replacement or gene flow accompanied the subsistence strategy transition process in the prehistoric West Liao River Valley [5].

 

서부 랴오 강 계곡은 구석기 시대부터 인간 점령의 오랜 역사를 가지고 있습니다. 남서쪽이나 북쪽에 대한 자연 장벽이 없기 때문에 사람들은 선사 시대 부터이 지역에서 자유롭게 움직였습니다. 그러나 이러한 인구 이동의 본질과 생존 전략의 전환에 대한 기여는 열띤 토론의 주제입니다. 특히 흥미로운 질문은 인구 교체 또는 유전자 흐름이 선사 시대 West Liao River Valley의 생존 전략 전환 과정을 수반했는지 여부이다 [ 5 ].

 

Modern techniques of molecular analysis provide ideal tools to investigate whether changes in cultures and modes of subsistence were mediated by population replacement or cultural exchange. The Y chromosome, with its uniparental inheritance and low mutation rate [6], is used widely for tracing the history of human populations. Y chromosome analyses of present-day populations of Northeast Asia have revealed four principal Y chromosome haplogroups—C, D, N, and O—and indicate that extant patterns of genetic variation in East Asia were shaped to a large extent by a southern migration of humans in the Palaeolithic [7,8]. Ancient DNA analyses are particularly appropriate for investigating past migrations over extended time scales, as is the case for the West Liao River valley, where genetic data from present-day populations would lack sufficient discriminatory power. A previous study of Y chromosome variation in five ancient populations by the Yangtze River revealed considerable differences between haplogroup distributions in ancient and present-day populations. For example, haplotype O3d, found at high frequency in the ancient Daxi site in the middle reaches of the Yangtze River, is very rare in living people, except in the Hmong-Mien population of southern China and Southeast Asia. This suggests the ancient Daxi migrated south and became the ancestors of the present Hmong-Mien [9]. In another study, Y chromosome analysis of the ancient Kurgan people helped to unravel some of the history of early migrations in the Eurasian steppe and also provided new insights into the history of the south Siberian Kurgans [10]. A similar approach may help shed light on the patterns of prehistoric migrations in the West Liao River valley region.

 

현대 분자 분석 기술은 문화 및 생존 방식의 변화가 인구 교체 또는 문화 교류에 의해 중재되었는지 여부를 조사하기위한 이상적인 도구를 제공합니다. 단일 염색체와 낮은 돌연변이율 [ 6 ]을 갖는 Y 염색체 는 인간 집단의 역사를 추적하는데 널리 사용된다. 현재 동북아 인구에 대한 Y 염색체 분석 결과 4 개의 주요 Y 염색체 일배 그룹 (C, D, N, O)이 밝혀졌으며 동아시아의 현존하는 유전 적 변이 패턴은 남부의 이주에 의해 크게 형성되었다. 구석기 시대의 인간 [ 7 , 8]. 오늘날의 인구로부터의 유전 데이터가 충분한 차별 력이 부족한 West Liao River 계곡의 경우와 같이, 고대 DNA 분석은 연장 된 시간 규모에 걸친 과거의 이주를 조사하는 데 특히 적합합니다. 양쯔강에 의한 5 개의 고대 인구에서의 Y 염색체 변이에 대한 이전의 연구는 고대와 현재 인구의 일 배수 군 분포 사이에 상당한 차이를 보여 주었다. 예를 들어, 장강 중반에 위치한 고대 Daxi 지역에서 높은 빈도로 발견되는 일배 체형 O3d는 중국 남부와 동남아시아의 몽족 민 인구를 제외하고는 살아있는 사람들에게는 매우 드물다. 이것은 고대 Daxi가 남쪽으로 이주하여 현재 몽족 민의 조상이되었다는 것을 암시한다 [ 9]. 또 다른 연구에서 고대 쿠르 간인에 대한 Y 염색체 분석은 유라시아 대초원에서 초기 이주의 역사를 밝히고 남부 시베리아 쿠르 간스의 역사에 대한 새로운 통찰력을 제공하는 데 도움이되었다 [ 10 ]. West Liao River 계곡 지역의 선사 시대 이주 패턴에 대해서도 비슷한 접근법이 도움이 될 수 있습니다.

 

In this study, prehistoric samples were collected from four archaeological sites representing the different time periods and cultures described above, and another two, the North nomad culture (Jinggouzi site) and the Yangshao Culture of the Yellow River valley (Miaozigou site) (Figure 1), were used as reference. We analyzed diagnostic single nucleotide polymorphisms (SNPs) in the non-recombining portion of the Y chromosome (NRY) of prehistoric samples (Table 1). A set of 17 Y short tandem repeats (STRs) were also analysed to confirm if ancient individuals of a particular haplogroup were related through the paternal line, even if buried in different tombs. They were also used to determine the detailed distribution of each haplogroup. By comparing our data with those from ancient and extant populations in the West Liao River valley and other surrounding regions in East Asia, we gained insight into the migration history and also evaluated genetic continuity in this region. These results will better help our understanding of the chief factors involved in the formation and transition of cultures in this region.

 

이 연구에서, 선사 시대 표본은 위에서 설명한 서로 다른시기와 문화를 나타내는 4 개의 고고 학적 유적지와 또 다른 2 개는 북쪽 유목 문화 (Jinggouzi 유적지)와 황 하계 양양 문화 (Miaozigou 유적지)에서 수집되었습니다 (그림  1). )를 참조로 사용 하였다. 우리는 선사 시대 샘플의 Y 염색체 (NRY)의 비 재조합 부분에서 진단 단일 뉴클레오티드 다형성 (SNPs)을 분석했습니다 (표  1). 또한 17 개의 짧은 탠덤 반복 (STR) 세트를 분석하여 특정 하 플로 그룹의 고대 개인이 다른 무덤에 묻혀 있어도 친계를 통해 관련되어 있는지 확인했습니다. 또한 각 haplogroup의 자세한 분포를 결정하는 데 사용되었습니다. 우리의 데이터를 West Liao River 계곡과 동아시아의 다른 주변 지역에있는 고대 및 현존 인구의 데이터와 비교함으로써 우리는 이주 역사에 대한 통찰력을 얻었으며이 지역의 유전 적 연속성을 평가했습니다. 이러한 결과는이 지역의 문화 형성 및 전환과 관련된 주요 요소를 이해하는 데 도움이 될 것입니다.

Table 1

Geographic locations and the Y-chromosome haplogroup distribution of prehistoric populations in this study

SiteCultureTime periodAgeLocationSample sizeN1(xN1a, N1c)N1cC/C3eO3a (O3a3)O3a3cNumberFrequencyNumberFrequencyNumberFrequencyNumberFrequencyNumberFrequency

Niuheliang

Hongshan Culture

Neolithic Age

6500-5000 BP

the border of Lingyuan County and Jianping County, Liaoning Province,China

6

4

66.7%

0

0

1(C)

13.7%

1

13.7%

0

0

Halahaigou

Xiaoheyan Culture

Neolithic Age

5000-4200 BP

Yuanbaoshan County,Chifeng city, Inner Mongolian Autonomous Region,China.

12

12

100.0%

0

0

0

0

0

0

0

0

Dadianzi

Lower Xiajiadian Culture

Early Bronze Age

4200-3600 BP

Aohan Banner,Chifeng city, Inner Mongolian Autonomous Region,China.

5

3

60.0%

0

0

0

0

2

40.0%

0

0

Dashanqian

Upper Xiajiadian culture

Late Bronze Age

3000-2700 BP

Harqin Banner,Chifeng city, Inner Mongolian Autonomous Region,China.

9

1

11.1%

3

33.3%

1(C3e)

11.1%

2

22.2%

2

22.2%

Jinggouzi

North nomad Culture

Late Bronze Age

3000-2500BP

Linxi County,Chifeng city, Inner Mongolian Autonomous Region,China.

12

0

0

0

0

12(C3e)

 

0

0

0

0

Miaozigou

Central Plain Culture

Neolithic Age

6000-5000BP

Chahar Right Front Banner, Ulanqab, Inner Mongolian Autonomous Region,China.

3

3

100.0%

0

0

0

0

0

0

0

0

Open in a separate window

Haplogroups were defined with the Y-SNP typing. Results are described in detail in Additional file 1.

Go to:

Results

Authenticity of the ancient DNA results

Strict procedures were used to prevent modern DNA contamination, and we regard our results as authentic based on a number of different observations: a) The negative extraction and amplification controls were always free of contamination; b) the results were repeatable and reproducible, as verified by performing at least two duplicated extractions, and two duplicated amplifications of each extract; c) the Y-SNP and Y-STR profiles of the ancient individuals were different from those of the laboratory researchers; and d) we observed an inverse relationship between amplification efficiency and the size of the Y chromosome STRs.

고대 DNA 결과의 진위

현대 DNA 오염을 방지하기 위해 엄격한 절차가 사용되었으며, 우리는 여러 가지 다른 관찰에 근거하여 결과를 확실한 것으로 간주합니다. a) 음성 추출 및 증폭 제어는 항상 오염이 없었습니다. b) 적어도 2 개의 중복 추출 및 각각의 추출에 대해 2 개의 중복 증폭을 수행함으로써 확인 된 바와 같이 결과는 반복 가능하고 재현 가능하다; c) 고대 개인의 Y-SNP 및 Y-STR 프로파일은 실험실 연구원의 프로파일과 다르다. d) 증폭 효율과 Y 염색체 STR의 크기 사이의 역의 관계를 관찰했다.

Y chromosome SNP analysis of ancient populations

The original sample consisted of 138 ancient individuals from six archaeological sites, of which 78 were classified as male using traditional morphological techniques. A further eight were found to be female by DNA typing of the sexually dimorphic amelogenin fragment. This left a total sample of 70 males, of which 23 either failed to amplify using Y chromosome SNP primers (21) or to yield consistent results (5). However, 47 of the 70 individuals, or over 60% of the samples tested, provided reproducible results. The 47 were then typed for a maximum of 18 Y chromosome SNPs (Figure 2), and could be classified into five different Y haplogroups (Additional file 1: Table S1). Some samples lacked sufficient DNA to permit further sub-classification.

고대 인구의 Y 염색체 SNP 분석

최초의 표본은 6 개의 고고 학적 유적지에서 온 138 명의 고대인으로 구성되었으며 그 중 78 개는 전통적인 형태 학적 기법을 사용하여 수컷으로 분류되었습니다. 성적으로 이형성 아 멜로 게닌 단편의 DNA 타이핑에 의해 추가로 8 개가 암컷 인 것으로 밝혀졌다. 이것은 총 70 명의 수컷 샘플을 남겼으며 그 중 23 개는 Y 염색체 SNP 프라이머를 사용하여 증폭하지 못했거나 (21) 일관된 결과를 얻지 못했습니다 (5). 그러나 70 명의 개체 중 47 명 또는 테스트 된 샘플의 60 % 이상이 재현 가능한 결과를 제공했습니다. 이어서, 47 개를 최대 18 개의 Y 염색체 SNP에 대해 타이핑하고 (도  2 ), 5 개의 상이한 Y 반수체 그룹으로 분류 할 수있다 (추가 파일 1 : 표 S1). 일부 샘플에는 추가 하위 분류를 허용하기에 충분한 DNA가 부족했습니다.

Open in a separate window

Figure 2

Phylogeny of Y-chromosomal haplogroups detected in this study.

 

 

The most ancient populations of the West Liao River valley exhibited a high frequency (71%) of haplogroup N1-M231. Because of the short amplicons needed for the ancient samples, it was not possible to type the diagnostic site P43 of sub-haplogroup N1b, so samples that yielded negative M128 and TAT mutations were defined as N1 (xN1A, N1c). Besides being the only haplogroup in the Halahaigou site, N1 (x N1a, N1c) was also predominant in the Niuheliang and Dadianzi sites. In the Dashanqian site, there were two subtypes of N1-M231: N1 (xN1a, N1c) and N1c-TAT. one of the nine Dashaqian samples was N1 (xN1a, N1c), and three were N1c (Table 1). N1 is particularly widespread in northern Eurasia, from the Far East to Eastern Europe. Its subtype, N1c, is found at low frequency but has high STR variability in northern China, suggesting that this region was N1c’s centre of expansion [11].

 

West Liao River 계곡의 가장 오래된 인구는 haplogroup N1-M231의 높은 빈도 (71 %)를 나타 냈습니다. 고대 샘플들에 필요한 짧은 앰플 리콘들 때문에, 서브-할로 그룹 N1b의 진단 부위 P43을 입력하는 것이 불가능하여, 음성 M128 및 TAT 돌연변이를 생성 한 샘플들은 N1 (xN1A, N1c)으로 정의되었다. Halahaigou 지역에서 유일한 haplogroup 인 것 외에도 N1 (x N1a, N1c)도 Niuheliang 및 Dadianzi 지역에서 우세했습니다. Dashanqian 사이트에는 N1-M231의 두 가지 하위 유형 인 N1 (xN1a, N1c)과 N1c-TAT가있었습니다. 9 개의 Dashaqian 샘플 중 하나는 N1 (xN1a, N1c)이고 3 개는 N1c입니다 (표  1). N1은 극동에서 동유럽에 이르기까지 유라시아 북부에서 특히 널리 퍼져 있습니다. 그것의 아형 인 N1c는 저주파에서 발견되지만 중국 북부에서 STR 변동성이 높기 때문에이 지역은 N1c의 확장 중심이었다 [ 11 ].

 

A single instance of O3a (xO3a3) was observed in the Neolithic Hongshan and Xiaoheyan sites, although this haplogroup was observed in just under half of the Bronze Age individuals. The Upper Xiajiadian individuals of the late Bronze Age had different subtypes of O3a-M324, O3a3c-M117. O3a-M324 is found today in most East Asian populations, and its subtype O3a3c-M117 occurs at the highest frequency in modern Sino-Tibetan populations [12,13].

 

신석기 홍산과 Xiaoheyan 사이트에서 O3a (xO3a3)의 단일 사례가 관찰되었지만,이 반수체 그룹은 청동기 시대 개인의 절반 미만에서 관찰되었습니다. 후기 청동기 후기 시아 지아 디안 개체는 O3a-M324, O3a3c-M117의 다른 하위 유형을 가졌습니다. O3a-M324는 오늘날 대부분의 동아시아 인구에서 발견되며, 아형 O3a3c-M117은 현대 시노-티베트 인구에서 가장 높은 빈도로 발생합니다 [ 12 , 13 ].

 

C3-M217 is the most widespread haplogroup in Central Asia, South Asia, Southeast Asia, East Asia, Siberia and the Americas, but is absent in Oceania. Its sub-branch C3e-P53.1 is found only in Northeast Asia with low STR diversity, suggesting a recent origin in this region [6]. All individuals with the haplogroup C3-M217 in the ancient populations of the West Liao River valley belonged to the sub-branch C3e, except one from the Niuheliang site, who had an unidentified subtype. one instance of C3e-P53.1 was found in the Dashanqian site, while all 12 individuals of the Jinggouzi site belonged to this subtype. The Jinggouzi people originated in the North China steppe, and our findings support the view that C3e originated in the north.

 

C3-M217은 중앙 아시아, 남아시아, 동남아시아, 동아시아, 시베리아 및 아메리카에서 가장 널리 퍼진 하 플로 그룹이지

만 오세아니아에는 없습니다. 하위 지점 C3e-P53.1은 STR 다양성이 낮은 동북 아시아에서만 발견되며이 지역의 최근 기원을 암시합니다 [ 6 ]. West Liao River 계곡의 고대 인구에서 haplogroup C3-M217을 가진 모든 개인은 미확인 하위 유형을 가진 Niuheliang 부지에서 하나를 제외하고 하위 지점 C3e에 속했습니다. Dashanqian 사이트에서 C3e-P53.1 사례가 발견되었으며 Jinggouzi 사이트의 12 명 모두가이 하위 유형에 속했습니다. Jinggouzi 사람들은 중국 북부 대초원에서 시작되었으며 우리의 발견은 C3e가 북쪽에서 시작되었다는 견해를 뒷받침합니다.

Y chromosome STR analysis

All ancient samples were analyzed at 17 Y chromosome STR loci. Due to DNA damage, only 21 of the 47 individuals yielded results for at least three loci in two independent extractions. Consensus data are reported in Additional file 1: Table S1. The DYS389II, DYS438 and DYS635 loci frequently failed to amplify, probably because of their longer length. The inverse relationship between amplification efficiency and PCR fragment is further support for the authenticity of the extracted DNA, as ancient DNA is presumably degraded while modern DNA contamination would exhibit longer fragment lengths.

Y 염색체 STR 분석

모든 고대 샘플은 17 Y 염색체 STR 유전자좌에서 분석되었습니다. DNA 손상으로 인해, 47 명의 개체 중 21 명만이 2 개의 독립적 추출에서 3 개 이상의 유전자좌에 대한 결과를 산출했다. 합의 데이터는 추가 파일 1 : 표 S1 에보고되어 있습니다. DYS389II, DYS438 및 DYS635 loci는 아마도 더 긴 길이 때문에 종종 증폭하지 못했습니다. 현대 DNA 오염이 더 긴 단편 길이를 나타내는 반면, 고대 DNA는 아마도 분해되기 때문에, 증폭 효율과 PCR 단편 사이의 역관계는 추출 된 DNA의 진위성을 추가로 지원한다.

 

There are only two Y-chromosome haplotypes in the Jinggouzi site suggesting that individuals are paternally closely related, despite being buried in separate tombs. In the other sites in our study, we detected no potential paternal relatives among ancient individuals of the same haplogroup.

 

Jinggouzi 사이트에는 두 개의 Y- 염색체 일배 체형 만이 존재하는데, 이는 개인이 별도의 무덤에 묻혀 있음에도 불구하고 아버지와 밀접하게 관련되어 있음을 시사합니다. 우리 연구의 다른 사이트들에서, 우리는 같은 haplogroup의 고대 개인들 사이에 잠재적 인 친족을 발견하지 못했습니다.

Go to:

Discussion

Y chromosome characteristics of the prehistoric population

The West Liao River valley was a cradle of Chinese civilization, together with the valleys of the Yellow River and Yangtze River, and there is considerable interest among scholars in the origin and expansions of the ancestors of the present-day inhabitants. Extensive analyses of extant populations have revealed that the most common Y chromosome haplogroup today is O-M175 (58.8%, n=176), followed by C3-M217(23.8%), N-M231(8.5%), and several relatively rare haplogroups, namely D-M174, Q1a1-M120, and R-M207 [8,14]. Our data reveal that the main paternal lineage in the prehistoric populations was N1 (xN1a, N1c), present in about 63% of our combined sample of all cultural complexes. It was the predominant haplogroup in the Neolithic period (89%), and declined gradually over time (Table 1). Today it is only found at low frequency in northeast Asia (Table 2). There appears to be significant genetic differences between ancient and extant populations of the West Liao River valley (P<0.001).

선사 시대 인구의 Y 염색체 특성

서 랴오 강 계곡은 황하강과 양쯔강 계곡과 함께 중국 문명의 요람이었으며 오늘날 거주민의 조상들의 기원과 확장에 학자들 사이에 상당한 관심이 있습니다. 현존 인구에 대한 광범위한 분석에 따르면 오늘날 가장 일반적인 Y 염색체 일배 그룹은 O-M175 (58.8 %, n = 176)이고,이어서 C3-M217 (23.8 %), N-M231 (8.5 %), 그리고 상대적으로 드문 것으로 나타났습니다 반수체 그룹, 즉 D-M174, Q1a1-M120 및 R-M207 [ 8 , 14 ]. 우리의 데이터는 선사 시대 인구의 주요 부계 혈통이 N1 (xN1a, N1c)이며 모든 문화 단지의 결합 된 표본의 약 63 %에 존재 함을 보여줍니다. 신석기 시대 (89 %)에서 우세한 일 배수 그룹이었고 시간이 지남에 따라 점차 감소했습니다 (표 1 ). 오늘날 동북 아시아에서는 빈도가 낮습니다 (표 2 ). 서 랴오 강 계곡의 고대 인구와 현존 인구 사이에는 상당한 유전 적 차이가있는 것으로 보입니다 (P <0.001).

Table 2

Frequency distribution of ancient Y-chromosome haplogroups in the extant populations of East Asia and North Asia

Geographical regionPopulationSizeotherN*N1 (×N1c,N1a)N1cC*C3eO*O3a (×O3a3c)O3a3cLiterature

West Liao-River valley

 

Prehistoric Population

32

0

0

50.0

9.4

3.1

3.1

0

15.6

6.3

This study

South East Asia

 

Buyi

35

5.7

5.7

0

0

0

0

60.0

17.1

11.4

Xue YL,2006

 

Li

34

0

0

0

0

0

0

97.1

0

2.9

Xue YL,2006

 

She

7

0

0

0

0

0

0

85.7

0

14.2

Sengupta S,2006

 

She

34

0

0

0

0

2.9

44.4

29.4

23.5

Xue YL,2006

 

She

51

0

0

0

0

0

0

94.1

0

5.9

Hammer F,2006

 

Hani

34

1

0

11.8

0

17.6

52.9

0

14.7

Xue YL,2006

 

Yao (Bama)

35

5.7

2.9

0

0

17.1

42.9

34.3

0

Xue YL,2006

 

Yao (Liannan)

35

0

0

0

0

2.9

25.7

51.4

20.0

Xue YL,2006

 

Qiang

33

33.3

0

0

0

0

0

39.4

6.1

21.2

Xue YL,2006

 

Yi

43

25.6

0

30.2

0

2.3

16.3

0

27.9

Hammer F,2006

 

Han (Chengdu)

34

0

0

2.9

0

11.8

55.9

0

29.4

Xue YL,2006

North East Asia

 

Han (Harbin)

35

2.9

0

2.9

2.9

14.3

40.0

0

37.1

Xue YL,2006

 

Han (Yili)

32

25.0

0

0

0

6.3

53.1

6.3

9.4

Xue YL,2006

 

Han

44

13.6

2.3

6.8

0

4.5

31.8

0

40.9

Hammer F,2006

 

Ewenki

26

7.7

0

0

0

57.7

15.4

0

19.2

Xue YL,2006

 

Ewenki

57

66.7

31.6

1.8

Zhong H,2010

 

Hezhe (Heilongjiang)

45

2.2

0

17.8

0

28.9

31.1

0

20.0

Xue YL,2006

 

Manchu (Liaonign)

52

9.6

1.9

3.8

0

26.9

42.3

0

15.4

Hammer F,2006

 

Manchu

35

5.7

5.7

8.6

0

25.7

34.3

0

20.0

Xue YL,2006

 

Mongolian

149

14.1

0

6.0

2.0

52.3

9.4

0

16.1

Hammer F,2006

 

Mongolian (innermongolia)

22

22.7

4.5

50.0

4.5

18.2

Zhong H,2010

 

Mongolian (innermongolia)

45

8.9

0

0

13.3

46.7

13.3

0

17.8

Xue YL,2006

 

Mongolian

65

23.1

0

3.1

7.7

53.8

6.2

0

6.2

Xue YL,2006

 

Uygur (Urumqi)

31

77.4

0

9.7

0

3.2

3.2

0

6.4

Xue YL,2006

 

Uygur (Yili)

39

66.7

0

25.6

5.1

10.3

5.1

0

10.3

Xue YL,2006

 

Korea (Yanji)

25

12.0

0

4.0

0

12.0

56.0

0

16.0

Xue YL,2006

 

Xibe (Xinjiang)

41

19.5

2.4

9.8

4.9

26.8

19.5

0

17.1

Xue YL,2006

 

Xibe (Xinjiang)

61

6.6

18.0

26.2

9.8

39.3

Zhong H,2010

 

Oroqen

31

3.2

0

6.5

0

61.3

16.1

6.5

6.5

Xue YL,2006

 

Oroqen

7

0

0

0

28.6

71.4

0

0

0

Sengupta S,2006

 

Oroqen

22

0

0

0

4.5

90.9

4.5

0

0

Hammer F,2006

 

Japan

47

59.6

38.3

4.3

0

10.6

2.1

0

21.3

Xue YL,2006

 

Japan

23

78.3

0

0

0

13.0

0

0

2

Sengupta S,2006

 

Dawoer

39

7.7

0

0

7.7

30.8

46.2

0

7.7

Xue YL,2006

 

Hui (Ningxia)

62

37.1

8.1

17.7

1.6

35.5

Zhong H,2010

 

Hui

35

48.6

0

0

0

22.9

22.9

0

5.7

Xue YL,2006

 

Tibetan

35

51.4

0

8.6

0

0

0

0

0

40.0

Xue YL,2006

 

Tibetan

105

59.0

0

2.9

0

1.9

2.9

0

34.3

Hammer F,2006

North Asia

 

Tuvan

55

45.5

0

10.9

27.3

14.5

0

1.8

0

0

Pakendorf B_2006

 

Yakut

184

3.3

0

0.5

94.0

2.2

0

0

0

0

Pakendorf B_2006

 

Evenk

40

2.5

0

27.5

0

70.0

0

0

0

0

Pakendorf B_2006

Open in a separate window

Note:

1. South East Asia and North East Asia populations are defined by the geographic separation of Yangtze River.

2. 一 indicates that no data exists for this population.

3. The * refer to all the other sub-haplogroups not used in this study.

 

 

Previous analyses showed that there were different frequency distributions of the sub-haplogroups used in this study in both ancient and extant populations of adjacent regions. The Yellow River valley, located in the southwest region of the West Liao River valley, was one original centre of agriculture in China. O3-M122 is the most abundant haplogroup in both ancient (80%, n=5) and extant population (53%, n=304) of the region [8,13], but the frequency of O3-M122 only began to rise in the West Liao River valley in the Bronze Age. The ancient West Liao River valley population is significantly different from both the ancient Yellow River Valley population (P<0.01), and the extant Yellow River Valley population (P<0.01). The Miaozigou site, about 500 km west of the West Liao River valley in the central/southern region of Inner Mongolia, was settled by people of the northern branch of the Yangshao culture, an important Neolithic farming culture along the Yellow River. Our analysis of three ancient Miaozigou individuals revealed that they all belong to haplogroup N1(xN1a, N1c), while the main lineage of the Yellow River valley culture is O3-M122 [9]. The existence of N1(xN1a, N1c) in the Miaozigou site could be evidence for the expansion of the Hongshan culture during its heyday, a view supported by archaeological evidence of Hongshan influences at the Miaozigou site [15]. However, the small sample size of our current ancient genetic material and the lack of data for earlier time periods means an alternate explanation [16], in which N1(xN1a, N1c) existed across the region prior to the Neolithic, is still a possibility.

 

이전의 분석은 인접 지역의 고대 및 현존 인구 모두에서이 연구에 사용 된 하위-합족 그룹의 빈도 분포가 다른 것으로 나타났습니다. 서 랴오 강 계곡의 남서쪽 지역에 위치한 황하 계곡은 중국의 최초 농업 중심지였습니다. O3-M122는 해당 지역의 고대 (80 %, n = 5) 및 현존 인구 (53 %, n = 304) 모두에서 가장 풍부한 일 배수 그룹이다 [ 8 , 13], 그러나 O3-M122의 빈도는 청동기 시대의 서 랴오 강 계곡에서만 상승하기 시작했습니다. 고대 서부 랴오 강 계곡 인구는 고대 황하 계곡 인구 (P <0.01)와 현존하는 황하 계곡 인구 (P <0.01)와 크게 다릅니다. 내몽고의 중앙 / 남부 지역에서 서쪽 랴오 강 계곡에서 서쪽으로 약 500km 떨어진 Miaozigou 부지는 황하 강을 따라 중요한 신석기 양식 문화 인 Yangshao 문화의 북부 지부의 사람들에 의해 정착되었습니다. 3 개의 고대 Miaozigou 개체에 대한 우리의 분석은 그들이 모두 haplogroup N1 (xN1a, N1c)에 속하고 황하 계곡 문화의 주요 계통은 O3-M122 [ 9]. Miaozigou 부지에 N1 (xN1a, N1c)의 존재는 전성기 동안 Hongshan 문화의 확장에 대한 증거가 될 수 있는데, 이는 Miaozigou 부지에서 홍산의 영향에 대한 고고 학적 증거에 의해 뒷받침된다 [ 15 ]. 그러나 현재의 고대 유전 물질의 작은 표본 크기와 초기 기간 동안의 데이터 부족은 신석기 이전의 지역에 걸쳐 N1 (xN1a, N1c)가 존재했던 대체 설명 [ 16 ]을 의미합니다. .

 

The main haplogroups of Northern steppe nomad population were C3 (50.7% in the Mongolian, n=285) [8,17,18], and N1c (94% in the Yakut, n=184) [19]. The ancient individuals from the Jinggouzi site, a Northern Steppe nomadic culture on the western fringes of the West Liao River valley, carry a single haplogroup, C3e, divided into two sub-types on the basis of Y chromosome STR analysis. Previous mtDNA data have shown that the Jinggouzi people have closely related mtDNA types [20], suggesting that the Jinggouzi site was settled by family groups migrating from the northern steppe within a short period, which is in agreement with archaeological results [21]. Therefore, the prehistoric people of the West Liao River valley carried the characteristic N1 (x N1a, N1c) lineage, and appear both culturally and genetically distinct.

 

북부 대초원 유목민 집단의 주요 일 배체 그룹은 C3 (몽골어에서 50.7 %, n = 285) [ 8 , 17 , 18 ] 및 N1c (야 쿠트에서 94 %, n = 184) [ 19 ]였다. 웨스트 랴오 강 계곡의 서쪽 가장자리에있는 북부 스텝 유목 문화 인 징구 지 (Jinggouzi) 지역의 고대인들은 Y 염색체 STR 분석에 기초하여 단일 하 플로 그룹 C3e를 두 가지 하위 유형으로 나눈다. 이전의 mtDNA 데이터에 따르면 징구 지 사람들은 mtDNA 유형과 밀접한 관련이있는 것으로 나타 났으며 [ 20 ], 징구 지 지역은 단기간 내에 북부 스텝에서 이주한 가족 그룹에 의해 정착되었으며, 이는 고고 학적 결과와 일치한다 [ 21]. 따라서 서 랴오 강 계곡의 선사 시대 사람들은 특징적인 N1 (x N1a, N1c) 혈통을 가지고 있으며 문화적으로나 유 전적으로 구별되는 것처럼 보입니다.

Prehistoric migrations in relation to cultural transitions

The Lower Xiajiadian culture (LXC) was an early Bronze Age culture with a highly developed agricultural society, with a subsistence strategy quite different from the hunting-gathering strategy typical of the Hongshan culture. However, the LXC people retained the microliths (tips of hunting weapons) and custom of dragon worship typical of the Hongshan culture. Most archaeologists agree that during the transition from the Neolithic to the Bronze Age, migrants carried farming technology from the Yellow River valley to surrounding areas including the West Liao River valley. In the Dadianzi people of the LXC, O3a is the main haplogroup after N1(xN1a, N1c). The former was previously shown to be the characteristic lineage for ancient populations along the Yellow River and Yangtze River valleys [9]. Previous mitochondrial DNA analyses of the Dadianzi population showed that the LXC people probably included immigrants from the Central Plains [22]. The archaeological analyses showed that farming tools and ceramic techniques can be traced to cultures from the Yellow River Basin [3]. Both the ancient genetic and archaeological data suggest that immigrants from the Yellow River valley, of type O3a, may have migrated into the West Liao River valley and influenced changes to the existing culture, but genetic drift cannot be ruled out as the cause for the observed frequencies.

문화적 전환과 관련된 선사 시대의 이주

로샤 샤 디안 문화 (LXC)는 고도로 발전된 농업 사회를 가진 초기 청동기 시대 문화로, 홍산 문화의 전형적인 사냥 수집 전략과는 상당히 다른 생존 전략이 있습니다. 그러나 LXC 사람들은 홍산 문화의 전형적인 미묘 석 (사냥 무기의 끝)과 용 숭배 관습을 유지했습니다. 대부분의 고고학자들은 신석기 시대에서 청동기 시대로 전환하는 동안 이민자들은 황하 계곡에서 서쪽 리아 오 강 계곡을 포함한 주변 지역으로 농업 기술을 전수했다고 동의합니다. LXC의 Dadianzi 사람들에서 O3a는 N1 (xN1a, N1c) 다음의 주요 일배 그룹입니다. 전자는 이전에 황하와 양쯔강 계곡을 따라 고대인들에게 특징적인 혈통이었다 [ 9]. Dadianzi 인구의 이전 미토콘드리아 DNA 분석에 따르면 LXC 사람들은 아마도 중앙 평원에서 온 이민자를 포함했을 것입니다 [ 22 ]. 고고학 분석에 따르면 농기구와 세라믹 기술이 황하 분지의 문화에 따라 추적 될 수 있음이 밝혀졌습니다 [ 3 ]. 고대 유전 및 고고 학적 데이터는 O3a 유형의 황하 계곡에서 온 이민자들이 서 랴오 강 계곡으로 이주하여 기존 문화의 변화에 ​​영향을 미쳤을 수 있지만, 유전 적 표류는 관찰 된 원인으로 배제 할 수 없음을 시사합니다 주파수.

 

The Upper Xiajiadian culture (UXC) of the late Bronze Age succeeded the LXC but was completely different from the LXC. The UXC people mainly practiced animal husbandry and made bronze objects decorated with animal and other natural motifs in the style of the Eurasian steppes. The UXC individuals of the Dashaqian site had higher Y chromosome haplogroup diversity, with a lower frequency of the LXC lineage. only one individual carried N1 (×N1a, N1c), the prevalent haplogroup before the UXC period. The O3-M122 type could have been inherited from LXC, but the existence of two different sub-types of O3, O3a (xO3a3) and O3a3c, implies continuous northward gene flow from the Yellow River valley. It is worth noting that the two northern haplogroups N1c and C3e first appeared in the ancient peoples of the Dashaqian site. N1c-TAT has the greatest frequency in populations from Northern Eurasia (see Table 2), and 94% of Yakuts belong to this haplogroup [19]. 33.3% of Dashaqian samples were N1c, and the present-day distribution of the ancient haplotype based on one STR profile search is mainly Northern Asia. The presence of N1c in the UXC might suggest that there is immigration from the north Eurasian steppes during this period.

 

청동기 말 후기 시아 지아 문화 (UXC)는 LXC에 성공했지만 LXC와는 완전히 달랐습니다. UXC 사람들은 주로 축산을 수행했으며 유라시아 대초원 스타일의 동물 및 기타 자연 모티프로 장식 된 청동 물건을 만들었습니다. Dashaqian 부위의 UXC 개체는 LXC 계통의 빈도가 더 낮은 Y 염색체 반수체 다양성이 더 높았다. 오직 한 명의 개체 만이 UXC 기간 이전에 우세한 일 배수 그룹 인 N1 (xN1a, N1c)을 운반했다. O3-M122 유형은 LXC에서 물려받을 수 있었지만, O3a (xO3a3)와 O3a3c의 두 가지 하위 유형이 존재한다는 것은 황하 계곡에서 북쪽으로 연속적인 유전자 흐름을 의미합니다. 두 개의 북부 일배 그룹 N1c와 C3e가 Dashaqian 사이트의 고대 사람들에게 처음 등장했다는 점은 주목할 가치가 있습니다. 2 ), Yakuts의 94 %가이 haplogroup에 속합니다 [ 19 ]. Dashaqian 샘플의 33.3 %는 N1c였으며, 하나의 STR 프로파일 검색을 기반으로 한 고대 haplotype의 현재 분포는 주로 북아시아입니다. UXC에 N1c가 존재하면이 기간 동안 북 유라시아 대초원에서 이민이 있음을 암시 할 수 있습니다.

 

The Jinggouzi site is situated northwest of the West Liao River Valley, and was occupied by northern nomadic tribes during similar time periods (3000-2500BP) as the Dashanqian site. All ancient samples of the Jinggouzi site were assigned to C3e, suggesting northern nomads might have entered the West Liao River valley from the northwest. C3e is rare in modern populations, and is only found in Northeast Asia.

 

징구 우지 (Jinggouzi) 부지는 서 랴오 강 계곡의 북서쪽에 위치하고 있으며 다 샨치 (Dasanqian) 부지와 비슷한시기 (3000-2500BP)에 북부 유목민들이 점령했다. Jinggouzi 부지의 모든 고대 표본은 C3e에 할당되어 북부 유목민이 북서부에서 서쪽 랴오 강 계곡에 들어갔을 수 있음을 시사합니다. C3e는 현대 인구에서는 드물며 동북 아시아에서만 발견됩니다.

 

Because the farming LXC was replaced by the nomadic UXC and no transitional type has yet been found, it had been suggested that there might have been large-scale immigration or even population replacement by northern Asian nomads [23]. Y chromosome data show immigration components from both northern steppe tribes and farmers from the Yellow River valley. However, because all original LXC lineages in this investigation were retained in the UXC gene pool, we tend to believe that while immigrant nomads from the north played an important part in the cultural transitions in this region, they probably did not replace the preceding populations in the West Liao River valley. Instead, the cultural transitions were more likely the result of adaptations to a new lifestyle caused by climate change.

 

농사 LXC가 유목 UXC로 대체되었고 아직 과도기 유형이 발견되지 않았기 때문에, 북아시아 유목민에 의한 대규모 이민 또는 인구 교체가있을 수 있다고 제안되었다 [ 23 ]. Y 염색체 데이터는 북부 스텝 부족의 이민 성분과 황하 계곡의 농부들을 보여줍니다. 그러나이 조사에서 모든 원래 LXC 계보가 UXC 유전자 풀에서 유지 되었기 때문에, 우리는 북쪽에서 온 이민 유목민들이이 지역의 문화적 전환에서 중요한 역할을했지만 이전의 인구를 대체하지는 않았을 것으로 생각합니다. 서쪽 랴오 강 계곡. 대신 문화적 변화는 기후 변화로 인한 새로운 생활 방식에 적응 한 결과 일 가능성이 더 큽니다.

Temporal continuity of paternal lineages in the West Liao River valley

The origin and development of the prehistoric populations of the West Liao River valley, a cross road of continuous migration events, is expected to involve complex processes and population admixture. Our prehistoric population data show that the principal lineages in the region remained relatively constant from the Neolithic to the Bronze Age. In the historic period, the region was controlled mainly by nomads, including the Nüzhen, Mongolians and Manchu. The genetic structure of this period can be deduced from data of Xibe, an extant minority in Xinjiang, from the northwestern region of China. The Xinjiang Xibe originated in Northeast China and were sent to Xinjiang in 1764 by the Qing emperor to defend the frontier [24]. This population carries the original Y chromosome lineages of the prehistoric population of the West Liao River valley, with a high frequency of C3e (Table 2), whose genetic structure is similar to that of the Upper Xiajiadian.

웨스트 리아 오 강 계곡에서 아버지 계보의 시간적 연속성

지속적인 이주 사건의 교차로 인 West Liao River 계곡의 선사 시대 인구의 기원과 발달은 복잡한 과정과 인구 혼입을 포함 할 것으로 예상됩니다. 우리의 선사 시대 인구 데이터에 따르면이 지역의 주요 계보는 신석기 시대부터 청동기 시대까지 비교적 일정하게 유지되었습니다. 역사적인시기에이 지역은 주로 zhen 젠, 몽골 인, 만주를 포함한 유목민들이 통제했습니다. 이시기의 유전자 구조는 중국 북서부 지역의 신장에 존재하는 소수 인 Xibe의 데이터에서 추론 할 수있다. 신장 Xibe 동북 중국에서 유래와 국경을 방어하기 위해 청나라 황제에 의해 1764 년 신장에 보내졌다 [ 24]. 이 집단은 웨스트 랴오 강 계곡의 선사 시대 집단의 원래 Y 염색체 계통을 가지고 있으며, C3e의 빈도가 높으며 (표 2 ), 그 유전자 구조는 샤아 (Xiajiadian  )와 유사하다.

 

In modern times, especially the last century, a massive number of immigrants from the south poured into this region. To investigate the extent of continuity in the paternal lineages, we examined the present-day patterns of distribution of the Y chromosome lineages observed in our ancient populations (Table 2). Except for O3a, the lineages of the prehistoric people are present today at low frequencies in the West Liao River valley. O3a continued to enter the West Liao River valley during the expansion of the Yellow River valley culture, displacing or replacing the original lineages. Today, N1 (xN1a, N1c) and C3e are mostly found in the northern Han and the northeast minority populations such as the Mongolians, Manchu, Oroqen, Xibe and Hezhe, although at low frequencies. Yi is the only population which has a relatively high frequency of N1 (xN1a,xN1c) in southern China. According to the archaeological record, one of the original branches of the ancestral Yi population was the Diqian, a nomadic ethnic group who lived in the northern steppes from 5000 to 3000 BP [25], which may explain the origin of N1(xN1a,xN1c) in the Yi people.

 

현대, 특히 지난 세기에는 남쪽에서 온 이민자들이이 지역에 쏟아졌습니다. 부계 혈통의 연속성 정도를 조사하기 위해 우리는 고대 인구에서 관찰 된 Y 염색체 혈통의 분포 패턴을 조사했습니다 (표  2).). O3a를 제외하고, 선사 시대 사람들의 혈통은 오늘날 웨스트 리아 오 강 계곡에서 낮은 빈도로 존재합니다. O3a는 황 하계 계곡 문화가 확장되면서 원래 계보를 대체하거나 교체하는 동안 계속해서 랴오 강 서쪽 계곡으로 들어갔다. 오늘날 N1 (xN1a, N1c) 및 C3e는 빈도가 낮지 만 몽골 인, 만주, 오로 첸, 시베 및 헤 셰프와 같은 북한 및 북동 소수 민족에서 주로 발견됩니다. Yi는 중국 남부에서 비교적 높은 빈도의 N1 (xN1a, xN1c)을 가진 유일한 인구입니다. 고고 학적 기록에 따르면, 조상 이족의 원래 지부 중 하나는 북부 대초원에서 5000에서 3000 BP까지 살았던 유목민 집단 인 디 키안 (Diqian)이었다 [ 25], Yi 사람들의 N1 (xN1a, xN1c)의 기원을 설명 할 수 있습니다.

Go to:

Conclusion

Our data demonstrate the temporal continuity of Y chromosome lineages in the populations of the West Liao River valley during the past 5000 years, with a concurrent increase in lineage diversity but at markedly different frequencies caused by the influx of immigrants from other populations. During the cultural transitions occurring in this region, the immigration had an effect on the genetic structure of populations in this region, but no population replacement was found. More ancient data from adjacent geographic regions and time periods, especially from the Yellow River Valley and Eastern Eurasian steppe, will be needed to more accurately describe the contribution of migration to cultural transition in this region.

 

우리의 데이터는 지난 5000 년 동안 웨스트 랴오 강 계곡의 인구에서 Y 염색체 혈통의 시간적 연속성을 보여줍니다. 혈통 다양성이 동시에 증가하지만 다른 인구의 이민자가 유입되어 현저하게 다른 빈도로 나타납니다. 이 지역에서 발생하는 문화적 전이 동안 이민은이 지역 인구의 유전 적 구조에 영향을 주었지만 인구 대체는 발견되지 않았습니다. 인접 지역과 기간, 특히 황하 계곡과 동부 유라시아 대초원의 더 오래된 데이터는이 지역의 문화적 전환으로의 이주의 기여를보다 정확하게 설명하기 위해 필요할 것입니다.

Go to:

Methods

Archaeological sites and samples

The geographic locations of the archaeological sites in this study have an average temperature of ca. 10°C, with a cold, dry climate excellent for the preservation of organic remains. The bone samples in this study were from six different archaeological sites: Niuheliang, Halahaigou, Dadianzi, Dashanqian, Jinggouzi, and Miaozigou. The first four are highly representative of the prehistory of the West Liao River valley, while the last two were used as references (Figure 1 and Table 1). The Jinggouzi was a typical Northern nomadic culture, and the Miaozigou represents the Yangshao Culture of the Yellow River valley. A number of different tombs were sampled for each cultural complex. Two teeth for each individual were collected for DNA analysis. Sex identification was performed using morphological and molecular methods as described previously [26].

고고학 유적지 및 샘플

이 연구에서 고고 학적 유적지의 지리적 위치는 평균 기온이 ca. 유기 잔류 물 보존에 탁월한 춥고 건조한 기후의 10 ° C. 이 연구의 뼈 샘플은 Niuheliang, Halahaigou, Dadianzi, Dashanqian, Jinggouzi 및 Miaozigou의 여섯 가지 고고학 유적지에서 얻은 것입니다. 처음 4 개는 West Liao River 계곡의 선사 시대를 대표하며 마지막 2 개는 참고 자료로 사용되었습니다 (그림  1 및 표  1).). Jinggouzi는 전형적인 북부 유목민 문화였으며 Miaozigou는 황하 계곡의 Yangshao 문화를 대표합니다. 각 문화 단지마다 다양한 무덤이 채집되었습니다. DNA 분석을 위해 각 개인에 대한 두 개의 치아를 수집했습니다. 앞에서 설명한 [ 26 ] 과 같은 형태 학적 및 분자 적 방법을 사용하여 성 식별을 수행 하였다 .

Methods to avoid DNA contamination and monitor authenticity

Appropriate precautions were taken to ensure the authenticity of the ancient DNA results. All pre-polymerase chain reaction (PCR) steps were performed in a positive pressure laboratory dedicated to ancient DNA located in the Research Center for Chinese Frontier Archaeology of Jilin University. Different rooms were used for sample preparation, DNA extraction, and setting up PCR. Post-PCR procedures were carried out in a different building. Surfaces were cleaned regularly with a 10% sodium hypochlorite solution and UV light (254 nm), and full-body protective clothing, facemasks and gloves were worn. Gloves were changed frequently. All consumables were purchased as DNA-free and additionally sterilized by autoclaving at 121°C for 15 min, while reagents were irradiated with UV light for at least 20 min. Every PCR assay included extraction and amplification controls. To check for reproducibility, the experiments were performed in parallel using duplicate teeth of each individual in the Molecular forensic lab in the College of Life Science of Jilin University. At least two PCR amplifications per SNP were done in each laboratory. To identify potential contamination from laboratory personnel, the mtDNA and STR profiles of all staff in the project were obtained. All pre-PCR steps were carried out by women, minimizing the risk of contamination by male DNA.

DNA 오염을 피하고 진위를 모니터링하는 방법

고대 DNA 결과의 신뢰성을 보장하기 위해 적절한 예방 조치를 취했습니다. 모든 예비-폴리머 라제 연쇄 반응 (PCR) 단계는 길림 대학교의 중국 프론티어 고고학 연구소에 위치한 고대 DNA 전용 양압 실험실에서 수행되었습니다. 시료 준비, DNA 추출 및 PCR 설정에 다른 방을 사용했습니다. PCR 후 절차는 다른 건물에서 수행되었습니다. 표면을 10 % 차아 염소산 나트륨 용액과 UV 광선 (254 nm)으로 정기적으로 청소하고 전신 보호 복, 안면 마스크 및 장갑을 착용했습니다. 장갑은 자주 바뀌었다. 모든 소모품은 DNA가없는 상태로 구입하고 121 ° C에서 15 분 동안 고압 증기 멸균 (autoclaving)하여 추가로 멸균하는 한편 시약에는 최소 20 분 동안 UV 광선을 조사했습니다. 모든 PCR 분석에는 추출 및 증폭 제어가 포함되었습니다. 재현성을 확인하기 위해 길림 대학교 생명 과학 대학 분자 법의학 실험실에서 각 개인의 이빨을 사용하여 실험을 병렬로 수행했습니다. SNP 당 적어도 두 개의 PCR 증폭이 각 실험실에서 수행되었습니다. 실험실 직원의 잠재적 오염을 식별하기 위해 프로젝트의 모든 직원의 mtDNA 및 STR 프로파일을 얻었습니다. 모든 사전 PCR 단계는 여성에 의해 수행되었으며, 남성 DNA에 의한 오염의 위험을 최소화했다. 실험실 직원의 잠재적 오염을 식별하기 위해 프로젝트의 모든 직원의 mtDNA 및 STR 프로파일을 얻었습니다. 모든 사전 PCR 단계는 여성에 의해 수행되었으며, 남성 DNA에 의한 오염의 위험을 최소화했다. 실험실 직원의 잠재적 오염을 식별하기 위해 프로젝트의 모든 직원의 mtDNA 및 STR 프로파일을 얻었습니다. 모든 사전 PCR 단계는 여성에 의해 수행되었으며, 남성 DNA에 의한 오염의 위험을 최소화했다.

DNA extraction

Teeth were soaked in a 10% sodium hypochlorite solution for 20 min, and washed with ultra-pure water and 100% alcohol. Each tooth was then exposed to UV light for 30 min on each side. The teeth were ground to fine powder in a 6750 Freezer Mill (Spex SamplePrep, USA), refrigerated with liquid nitrogen, and stored at −20°C. For each extraction, a quantity of ground tooth (ca. 0.2 g) was incubated for 24h at 50°C with shaking (220 rpm/min), in 4 ml of an incubation buffer consisting of 0.5M EDTA, 0.5% SDS and 3 mg/ml proteinase K. Afterwards, the DNA was purified using the QIAquick PCR Purification Kit (Qiagen, Germany), according to the manufacturer’s protocol. A short fragment of the D-loop region in the mitochondrial genome (nt16052-16142) was amplified for each sample. only the samples which had positive PCR product would be tested further for nuclear genetic material.

DNA extracts were quantified by real time PCR, using an ABI Prism 5700 Sequence Detection System (Applied Biosystems, USA) and the Quantifiler® Human DNA Quantification Kit (Applied Biosystems, USA) according to the manufacturer’s protocol.

DNA 추출

치아를 10 % 차아 염소산 나트륨 용액에 20 분 동안 담그고 초순수 및 100 % 알코올로 세척 하였다. 각 치아를 각면에서 30 분 동안 UV 광선에 노출시켰다. 6750 냉동고 분쇄기 (Spex SamplePrep, USA)에서 치아를 미세 분말로 분쇄하고, 액체 질소로 냉장하고, -20 ℃에서 보관 하였다. 각각의 추출에 대해, 0.5M EDTA, 0.5 % SDS 및 3으로 구성된 인큐베이션 버퍼 4 ml에서, 양의 분쇄 된 치아 (약 0.2 g)를 진탕 (220 rpm / 분)으로 50 ℃에서 24 시간 동안 인큐베이션 하였다. 그 후, 제조사의 프로토콜에 따라 QIAquick PCR Purification Kit (Qiagen, Germany)를 사용하여 DNA를 정제 하였다. 미토콘드리아 게놈 (nt16052-16142)에서 D- 루프 영역의 짧은 단편을 각각의 샘플에 대해 증폭시켰다.

제조사의 프로토콜에 따라 ABI 프리즘 5700 서열 검출 시스템 (Applied Biosystems, USA) 및 Quantifiler® Human DNA Quantification Kit (Applied Biosystems, USA)를 사용하여 실시간 PCR에 의해 DNA 추출물을 정량화 하였다.

Y chromosome STR and SNP analysis

Eighteen biallelic markers (Figure 2) that characterize the most prevalent lineages in Eastern Asia were tested using a hierarchical genotyping strategy [27]. First, the six Y chromosome markers C-M216, F-M89, K-M9, P-M45, NO-M214 and N-M231 were genotyped. Afterwards, the C-M216-derived individuals were subjected to further typing of four biallelic markers, C3-M217, C3c-M48, C3d-M407, and C3e-P53.1, which define four sub-haplogroups. The NO-M214-derived individuals were further typed at eight biallelic markers, N1a-M128, N1b-P43, N1c-TAT, O-M175, O3-M122, O3a-M324, O3a3-p201, and O3a3c-M117, which define six sub-haplogroups. Primers for PCR amplification were designed using Primer Premier 5.0, and primer sequences are shown in Table 3. PCR amplifications were done as described by Karafet et al. (2008), but increasing the number of cycles to 40, using previously described primers [28,29]. The length of the PCR amplicons was typically between 100 and 200 base pairs (bp). Together with the published data [6,8,17,18,22,30], the frequencies of ancient haplogroups in extant Asia populations are summarized in Table 2. The significance analysis of difference in haplogroup frequency was performed using Fisher’s exact test for the ancient populations due to small sample size, otherwise we use the chi square test.

Y 염색체 STR 및 SNP 분석

동아시아에서 가장 널리 알려진 계통을 특징 짓는 18 개의 대립 형 마커 (그림  2 )는 계층 적 유전자형 분석 전략을 사용하여 테스트되었습니다 [ 27 ]. 먼저, 6 개의 Y 염색체 마커 C-M216, F-M89, K-M9, P-M45, NO-M214 및 N-M231을 유전자형 화 하였다. 그 후, C-M216- 유래 된 개체는 4 개의 하위-할로 그룹을 정의하는 4 개의 이중 대립 마커, C3-M217, C3c-M48, C3d-M407 및 C3e-P53.1을 추가로 타이핑 하였다. NO-M214- 유도 된 개체는 8 개의 이중 대립 마커, N1a-M128, N1b-P43, N1c-TAT, O-M175, O3-M122, O3a-M324, O3a3-p201 및 O3a3c-M117에 추가로 타이핑되었다 : 여섯 하위 하위 그룹. PCR 증폭을위한 프라이머는 Primer Premier 5.0을 사용하여 설계되었으며 프라이머 서열은 표 3 에 나와 있습니다. . Karafet et al.에 의해 기술 된 바와 같이 PCR 증폭이 수행되었다. (2008), 이전에 설명한 프라이머를 사용하여 사이클 수를 40으로 늘림 [ 28 , 29 ]. PCR 앰플 리콘의 길이는 전형적으로 100 내지 200 개의 염기쌍 (bp)이었다. 발표 된 데이터 [ 6 , 8 , 17 , 18 , 22 , 30 ]와 함께, 현존 아시아 인구의 고대 haplogroup의 빈도가 표 2에 요약되어  있습니다. 작은 표본 크기로 인해 고대 인구에 대한 Fisher의 정확한 검정을 사용하여 haplogroup 빈도 차이의 유의성 분석을 수행했습니다. 그렇지 않으면 카이 제곱 검정을 사용합니다.

Table 3

Information for the 18 Y-SNP markers and primer sequences

MarkerAmplicon size (bp)PCR primer sequnces (5’→3’)Test method  ForwardReverse

C/M216

109bp

TCACTTTTATATCCTCAACCA

AATCTGAATTCTGACACTGC

Sequence

C3/M217

101bp

ACTTGTGAAGGAGAATGAAAA

GCATTTGATAAAGCTGCTGTG

Sequence

C3c/M48

140bp

AAACAATATGTATGCTAATTTTGCT

TCAATGTAAATGTTAGTATAAGGATG

Sequence

C3d/M407

114bp

TCTTACTGAAAGTTGGGGAC

GATAATCGCTTGTCTCTTGG

Sequence

C3e/P53.1

123bp/121bp

AAACCCTGGAGAGGACCAACGA

ACACTATGAACCAATCCCACCC

Sequence

F/M89

125bp

CCACAGAAGGATGCTGCTCA

CACACTTGGGTCCAGGATCAC

Sequence

K/M9

128bp

GGACCCTGAAATACAGAAC

AAGCGCTACCTTACTTACAT

Sequence

P/M45

129bp

GGGTGTGGACTTTACGAAC

AAATCCTACTATCTCCTGGC

Sequence

NO /M214

119bp

MACTGGAAAGAAAAAGAATGCTG

ATGGAAATGCCACTTCACTC

Sequence

N/M231

113bp

CCTGGAAAATGTGGGCTC

TTCTTTGACGATCTTTCCCC

Sequence

N1a/M128

123bp/121bp

ATCTACCTCTTTCAAACTGT

GAACTGCCTCTTATAAAATCAT

Sequence

N1b/P43

108bp

ACGGAGTCTCGCTCTGTCG

GCTACTTGGGAGGCTGAGG

Sequence

N1c/Tat

115bp

GAGAAGGTGCCGTAAAAGTG

GGACTCTGAGTGTAGACTTGTG

Sequence

O/M175

110bp/105bp

TCAACTCAACTCCAGTGATTTA

TAATGATACCTTTTTTTCTACTGA

PAGE

O3/M122

120bp

CAGATACTGTGACTTTGAG

GAAATGAATAAATCAAGGT

Sequence

O3a/M324

120bp

GGAACATAGCAAGACCCAAAAT

CAAATTGATTTCCAGGGATACAT

Sequence

O3a3/P201

114BP

FTAAGCAATGAAGGTAGAAGG

ATTTAGAATAATATTTACTGAGCA

Sequence

O3a3c/M117

117bp/113bp

AAAATAACTCACCAAAGGAAT

AGATGATAGAAAAACATAATA

PAGE

Open in a separate window

PAGE: Polyacrylamide gel electrophoresis.

 

Y chromosome STR of the ancient samples was performed on 17 loci (DYS19, DYS385, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS447, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 and Y GATA H4) using the AGCU® mini STR Kit (AGCU ScienTech, China). Experimental conditions were as recommended by the manufacturer, but the number of PCR cycles was increased to 40. STR products were analyzed on an ABI Prism 310 Genetic Analyzer with GeneMapper software 4.2. The STR haplotypes were examined to identify potential paternal relationships, and each STR profile was cross-checked with the Y chromosome Haplotype Reference Database (YHRD) (http://www.yhrd.org).

 

고대 샘플의 Y 염색체 STR은 17 개 유전자좌에서 수행되었다 (DYS19, DYS385, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS447, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 및 Y GATA HYS) AGCU ® 미니 STR 키트 (AGCU ScienTech, 중국). 실험 조건은 제조업체가 권장 한대로 였지만 PCR 사이클 수는 40 개로 증가했습니다. STR 제품은 GeneMapper 소프트웨어 4.2를 사용하는 ABI Prism 310 유전자 분석기에서 분석되었습니다. 잠재적 인 친족 관계를 식별하기 위해 STR 일배 체형을 조사하고, 각각의 STR 프로파일을 Y 염색체 일배 체형 참조 데이터베이스 (YHRD) ( http://www.yhrd.org ) 로 교차 점검 하였다 .

Go to:

Availability of supporting data

The data set supporting the results of this article is included within the article and its additional file.

Go to:

Competing interests

The authors declare no competing interests.

Go to:

Supplementary Material

Additional file 1: Table S1:

Detailed sample information, Y-SNP and Y-STR genotype data.

Click here for file(20K, xlsx)

Go to:

Acknowledgements

This work was supported by grants from the National Natural Science Foundation of China (Grant No.31371266 and J1210007), the National Social Science Foundation of China (11&ZD182) and MOE Project of Humanities and Social Science (general project), 10YJC780004. We are grateful to the Liaoning Cultural Relics and the Archaeology Institute for providing the human remains. Our special thanks goes to Melinda A. Yang for revising and commenting on the manuscript.

Go to:

References

  • Liu G. Conspectus of the Ancient Culture from Neolithic Age to the Forepart of Bronze Age in Xiliaohe River Area. Journal Liaoning Normal University. 2006;01:113–122. [Google Scholar]

  • Ma LQ. The Origin of Lower Xiajiadian Culture. Journal of InnerMongolia University (Philosophy and Social Sciences) 1996;06:24–29. [Google Scholar]

  • Tian GL. Form of the Social Development of the Lower Xiajiadian Culture Period in the West Liaohe River Valley. Archaeology. 2006;03:45–52. [Google Scholar]

  • Chen SY, Liu YP, Wang W, Gao CZ, Yao YG, Lai SJ. Dissecting the matrilineal components of Tongjiang cattle from southwest China. Biochem Genet. 2008;46(3–4):206–215. [PubMed] [Google Scholar]

  • TIAN GL. on the Characteristics of Ancient Culture Development in Xiliaohe Area in Prehistoric Northeast and Its Division of History. Journal of Liaoning Normal University (Social Science Edition) 2004;01:111–114. [Google Scholar]

  • Zhong H, Shi H, Qi XB, Xiao CJ, Jin L, Ma RZ, Su B. Global distribution of Y-chromosome haplogroup C reveals the prehistoric migration routes of African exodus and early settlement in East Asia. J Hum Genet. 2010;55(7):428–435. doi: 10.1038/jhg.2010.40. [PubMed] [CrossRef] [Google Scholar]

  • Cai X, Qin Z, Wen B, Xu S, Wang Y, Lu Y, Wei L, Wang C, Li S, Huang X. et al.Human migration through bottlenecks from Southeast Asia into East Asia during Last Glacial Maximum revealed by Y chromosomes. PLoS one. 2011;6(8):e24282. doi: 10.1371/journal.pone.0024282. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

  • Zhong H, Shi H, Qi XB, Duan ZY, Tan PP, Jin L, Su B, Ma RZ. Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route. Mol Biol Evol. 2010;28(1):717–727. [PubMed] [Google Scholar]

  • Li H, Huang Y, Mustavich LF, Zhang F, Tan JZ, Wang LE, Qian J, Gao MH, Jin L. Y chromosomes of prehistoric people along the Yangtze River. Hum Genet. 2007;122(3–4):383–388. [PubMed] [Google Scholar]

  • Keyser C, Bouakaze C, Crubezy E, Nikolaev VG, Montagnon D, Reis T, Ludes B. Ancient DNA provides new insights into the history of south Siberian Kurgan people. Hum Genet. 2009;126(3):395–410. doi: 10.1007/s00439-009-0683-0. [PubMed] [CrossRef] [Google Scholar]

  • Rootsi S, Zhivotovsky LA, Baldovic M, Kayser M, Kutuev IA, Khusainova R, Bermisheva MA, Gubina M, Fedorova SA, Ilumae AM. et al.A counter-clockwise northern route of the Y-chromosome haplogroup N from Southeast Asia towards Europe. Eur J Hum Genet. 2007;15(2):204–211. doi: 10.1038/sj.ejhg.5201748. [PubMed] [CrossRef] [Google Scholar]

  • Kang L, Lu Y, Wang C, Hu K, Chen F, Liu K, Li S, Jin L, Li H. Y-chromosome O3 haplogroup diversity in Sino-Tibetan populations reveals two migration routes into the eastern Himalayas. Ann Hum Genet. 2011;76(1):92–99. [PubMed] [Google Scholar]

  • Shi H, Dong YL, Wen B, Xiao CJ, Underhill PA, Shen PD, Chakraborty R, Jin L, Su B. Y-chromosome evidence of sohern origin of the East Asian-specific haplogroup O3-M122. Am J Hum Genet. 2005;77:3408–3419. [PMC free article] [PubMed] [Google Scholar]

  • Xue F, Wang Y, Xu S, Zhang F, Wen B, Wu X, Lu M, Deka R, Qian J, Jin L. A spatial analysis of genetic structure of human populations in China reveals distinct difference between maternal and paternal lineages. Eur J Hum Genet. 2008;16(6):705–717. doi: 10.1038/sj.ejhg.5201998. [PubMed] [CrossRef] [Google Scholar]

  • G-q C. Analysis on the mutual movement relation between Xiaoheyan Culture and other archaeology culture. Research of China's Frontier Archaeology. 2009;01:36–46. [Google Scholar]

  • Silvia ES, Geoffrey H, Graciela SC, Chad H, Joan BC, Dennis HOR. Inferring population continuity versus replacement with aDNA: A cautionary tale from the Aleutian Islands. Hum Biol. 2009;81:407–426. doi: 10.3378/027.081.0402. [PubMed] [CrossRef] [Google Scholar]

  • Xue Y, Zerjal T, Bao W, Zhu S, Shu Q, Xu J, Du R, Fu S, Li P, Hurles ME. et al.Male demography in East Asia: a north–south contrast in human population expansion times. Genetics. 2006;172(4):2431–2439. [PMC free article] [PubMed] [Google Scholar]

  • Hammer MF, Karafet TM, Park H, Omoto K, Harihara S, Stoneking M, Horai S. Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes. J Hum Genet. 2006;51(1):47–58. doi: 10.1007/s10038-005-0322-0. [PubMed] [CrossRef] [Google Scholar]

  • Pakendorf B, Novgorodov IN, Osakovskij VL, Danilova AP, Protod'jakonov AP, Stoneking M. Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts. Hum Genet. 2006;120(3):334–353. doi: 10.1007/s00439-006-0213-2. [PubMed] [CrossRef] [Google Scholar]

  • Wang H, Chen L, Ge B, Zhang Y, Zhu H, Zhou H. Genetic Data Suggests that the Jinggouzi People are Associated with the Donghu, an Ancient Nomadic Group of North China. Hum Biol. 2012;84(4):365–378. doi: 10.3378/027.084.0402. [PubMed] [CrossRef] [Google Scholar]

  • Wu Z. A Preliminary Study on the Elements and Formation Process of the Culture Reflected from the Western Jinggouzi Cemetery. Huaxia Archaeology. 2009;01:87–101. [Google Scholar]

  • Li H, Zhao X, Zhao Y, Li C, Si D, Zhou H, Cui Y. Genetic characteristics and migration history of a bronze culture population in the West Liao-River valley revealed by ancient DNA. J Hum Genet. 2011;56(12):815–822. doi: 10.1038/jhg.2011.102. [PubMed] [CrossRef] [Google Scholar]

  • Fengyi J. The Upper Xiajiadian Culture and Its Ethnic Attributionv. Acta Archaeologia Sinica. 1987;02:177-208–275-276. [Google Scholar]

  • He Y-m. The Influence of Xibe Nationality's Westward Movement on Xibe's Culture. NW Ethno-National Studies. 2006;02:64-71–149. [Google Scholar]

  • Me M. The origin of yi ethnic group. Thinking. 1980;01:81–88. [Google Scholar]

  • Rogers TL. Determining the sex of human remains through cranial morphology. J Forensic Sci. 2005;50(3):493–500.25. [PubMed] [Google Scholar]

  • Hammer MF, Karafet TM, Redd AJ, Jarjanazi H, Santachiara-Benerecetti S, Soodyall H, Zegura SL. Hierarchical patterns of global human Y-chromosome diversity. Mol Biol Evol. 2001;18(7):1189–1203. doi: 10.1093/oxfordjournals.molbev.a003906. [PubMed] [CrossRef] [Google Scholar]

  • Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF. New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Genome Res. 2008;18(5):830–838. doi: 10.1101/gr.7172008. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

  • Hudjashov G, Kivisild T, Underhill PA, Endicott P, Sanchez JJ, Lin AA, Shen P, Oefner P, Renfrew C, Villems R. et al.Revealing the prehistoric settlement of Australia by Y chromosome and mtDNA analysis. Proc Natl Acad Sci USA. 2007;104(21):8726–8730. doi: 10.1073/pnas.0702928104. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

  • Sengupta S, Zhivotovsky LA, King R, Mehdi SQ, Edmonds CA, Chow CE, Lin AA, Mitra M, Sil SK, Ramesh A. et al.Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. Am J Hum Genet. 2006;78(2):202–221. doi: 10.1086/499411. [PMC free article] [PubMed] [CrossRef] [Google Scholar]


Articles from BMC Evolutionary Biology are provided here courtesy of BioMed Central